Journal: Oncology Research

Article Title: RNAi-Mediated Downregulation of FKBP14 Suppresses the Growth of Human Ovarian Cancer Cells

doi: 10.3727/096504016X14549667333963

Figure Lengend Snippet: FKBP14 expression in ovarian cancer tissues and cell lines. (A) The expression level of FKBP14 in ovarian cancer tissues ( n = 40) was examined by qRT-PCR. (B) Expression of FKBP14 was higher in 34 ovarian tissues than in their pair-matched adjacent normal tissues. Each bar represents the log2 ratio of FKBP14 expression in each cancer sample and normal control. Positive log2 is represented in gray, and negative log2 is in white. (C) The expression level of FKBP14 by immunohistochemistry staining in 75 ovarian cancer tissues. mRNA (D) and protein (E) levels of FKBP14 were evaluated in five ovarian cancer cells. GAPDH was used as a loading control.

Article Snippet: Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and nonsilencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector (Addgene, Cambridge, MA, USA).

Techniques: Expressing, Quantitative RT-PCR, Control, Immunohistochemistry, Staining

Journal: Oncology Research

Article Title: RNAi-Mediated Downregulation of FKBP14 Suppresses the Growth of Human Ovarian Cancer Cells

doi: 10.3727/096504016X14549667333963

Figure Lengend Snippet: Correlations Between FKBP14 Expression and Clinicopathologic Features in Patients With Ovarian Cancer

Article Snippet: Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and nonsilencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector (Addgene, Cambridge, MA, USA).

Techniques: Expressing

Journal: Oncology Research

Article Title: RNAi-Mediated Downregulation of FKBP14 Suppresses the Growth of Human Ovarian Cancer Cells

doi: 10.3727/096504016X14549667333963

Figure Lengend Snippet: Knockdown of FKBP14 inhibited the proliferation of ovarian cancer cells. (A, B) Identification of FKBP14 knockdown efficiency using shRNA lentivirus by Western blotting in SKOV3 and HO8910 cells. (C, D). Treated or nontreated cells seeded onto 96-well plates, and cell viability was determined at indicated time points by CCK-8 assay. Assays were performed in triplicate. WT, nontreated cells; NC, nonsilencing shRNA lentivirus; RNAi, FKBP14 shRNA lentivirus. *** p < 0.001 compared with NC.

Article Snippet: Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and nonsilencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector (Addgene, Cambridge, MA, USA).

Techniques: Knockdown, shRNA, Western Blot, CCK-8 Assay

Journal: Oncology Research

Article Title: RNAi-Mediated Downregulation of FKBP14 Suppresses the Growth of Human Ovarian Cancer Cells

doi: 10.3727/096504016X14549667333963

Figure Lengend Snippet: FKBP14 silencing induced a G 0 /G 1 arrest and cell apoptosis in ovarian cancer cells. (A) FACS histograms and cell cycle distribution analysis of SKOV3 and HO8910 cells by PI staining at 48 h after lentivirus infection. (B) Cell apoptosis analysis by Annexin-V-FITC/PI staining at 48 h after lentivirus infection. WT, nontreated cells; NC, nonsilencing shRNA lentivirus; RNAi, FKBP14 shRNA lentivirus. ** p < 0.01, *** p < 0.001 compared with NC.

Article Snippet: Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and nonsilencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector (Addgene, Cambridge, MA, USA).

Techniques: Staining, Infection, shRNA

Journal: Oncology Research

Article Title: RNAi-Mediated Downregulation of FKBP14 Suppresses the Growth of Human Ovarian Cancer Cells

doi: 10.3727/096504016X14549667333963

Figure Lengend Snippet: Effect of FKBP14 shRNA on the protein expressions of PCNA, cleaved caspase 3, Bcl-2, and Bax was evaluated by Western blotting. Representative Western blotting (upper panel) and quantitative analysis based on three independent experiments (lower panel) are shown. WT, nontreated cells; NC, nonsilencing shRNA lentivirus; RNAi, FKBP14 shRNA lentivirus. ** p < 0.01, *** p < 0.001 compared with NC.

Article Snippet: Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and nonsilencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector (Addgene, Cambridge, MA, USA).

Techniques: shRNA, Western Blot

Journal: Oncology Research Featuring Preclinical and Clinical Cancer Therapeutics

Article Title: RNAi-Mediated Downregulation of FKBP14 Suppresses the Growth of Human Ovarian Cancer Cells

doi: 10.3727/096504016x14549667333963

Figure Lengend Snippet: Figure 2. Knockdown of FKBP14 inhibited the proliferation of ovarian cancer cells. (A, B) Identification of FKBP14 knockdown efficiency using shRNA lentivirus by Western blotting in SKOV3 and HO8910 cells. (C, D). Treated or nontreated cells seeded onto 96-well plates, and cell viability was determined at indicated time points by CCK-8 assay. Assays were performed in triplicate. WT, nontreated cells; NC, nonsilencing shRNA lentivirus; RNAi, FKBP14 shRNA lentivirus. ***p < 0.001 compared with NC.

Article Snippet: Lentiviral Vector Production Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and nonsilencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector (Addgene, Cambridge, MA, USA).

Techniques: Knockdown, shRNA, Western Blot, CCK-8 Assay

Journal: Oncology Research Featuring Preclinical and Clinical Cancer Therapeutics

Article Title: RNAi-Mediated Downregulation of FKBP14 Suppresses the Growth of Human Ovarian Cancer Cells

doi: 10.3727/096504016x14549667333963

Figure Lengend Snippet: Figure 3. FKBP14 silencing induced a G0/G1 arrest and cell apoptosis in ovarian cancer cells. (A) FACS histograms and cell cycle dis- tribution analysis of SKOV3 and HO8910 cells by PI staining at 48 h after lentivirus infection. (B) Cell apoptosis analysis by Annexin- V-FITC/PI staining at 48 h after lentivirus infection. WT, nontreated cells; NC, nonsilencing shRNA lentivirus; RNAi, FKBP14 shRNA lentivirus. **p < 0.01, ***p < 0.001 compared with NC.

Article Snippet: Lentiviral Vector Production Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and nonsilencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector (Addgene, Cambridge, MA, USA).

Techniques: Staining, Infection, shRNA

Journal: Oncology Research Featuring Preclinical and Clinical Cancer Therapeutics

Article Title: RNAi-Mediated Downregulation of FKBP14 Suppresses the Growth of Human Ovarian Cancer Cells

doi: 10.3727/096504016x14549667333963

Figure Lengend Snippet: Figure 4. Effect of FKBP14 shRNA on the protein expressions of PCNA, cleaved caspase 3, Bcl-2, and Bax was evaluated by Western blotting. Representative Western blotting (upper panel) and quantitative analysis based on three independent experiments (lower panel) are shown. WT, nontreated cells; NC, nonsilencing shRNA lentivirus; RNAi, FKBP14 shRNA lentivirus. **p < 0.01, ***p < 0.001 compared with NC.

Article Snippet: Lentiviral Vector Production Small interfering RNA (siRNA) targeting FKBP14 sequence (GACCACTTTCACTGATTAT) and nonsilencing sequence (CCTAAGGTTAAGTCGCCCTCG) were transformed into short hairpin RNA (shRNA) and were cloned into PLKO.1-lentiviral vector (Addgene, Cambridge, MA, USA).

Techniques: shRNA, Western Blot

Journal: Nature communications

Article Title: Suppression of stress granule formation is a vulnerability imposed by mutant p53.

doi: 10.1038/s41467-025-57539-6

Figure Lengend Snippet: Fig. 8 | A proposed model of SG suppression and increased SOR sensitivity by mutp53. Mutp53 inhibits ER stress-mediated formation of SGs by interacting with PERK and G3BP1, which contributes to enhanced sensitivity to ER stress inducers like SOR. Created in BioRender. Iwakuma, T. (2025) https://BioRender.com/h97c210.

Article Snippet: Gene knockdown and knockout for p53 and G3BP1 To knockdown p53 or G3BP1, cells were infected with a lentiviral vector shp53 pLKO.1 puro targeting p53 exon 7/8 (19119, Addgene), a pLVshRNA-Bsd-U6-hTP53 targeting p53 3’UTR (VectorBuilder), or a pGIPz vector encoding shRNA for G3BP1 (RHS4430-200239796, Horizon Discovery, Lafayette, CO, USA), while an empty lentiviral vector pCDH-CMV-MCS-EF1α-Puro (pCDH-EF-puro, CD510B-1, System Biosciences, Palo Alto, CA, USA) or a pGIPz nonsilencing shRNAmir lentiviral control vector (RHS4346, Horizon Discovery) was used as a negative control. p53-knockout cells were made by infection with a p53 sgRNA lentiviral vector (pXPR003-sgTP53-4, 118022, Addgene) and an adenoviral vector encoding GFP-Cas9 (1901, VECTOR BIOLABS, Malvern, PA, USA), followed by single colonization.

Techniques:

Journal: Nature communications

Article Title: Suppression of stress granule formation is a vulnerability imposed by mutant p53.

doi: 10.1038/s41467-025-57539-6

Figure Lengend Snippet: Fig. 2 | Mutp53 enhances the sensitivity of HCC and other types of cancer cells to ER stress. a WB for p53 and GAPDH and Annexin V/PI and flow cytometry using control vector and mutp53-knockdown (shp53) KHOS/NP cells, treated with 25 µM VCR, 3 µM DRB, or 1.5 µM CDDP for 72 h. A graph showing the percent of apoptosis and total cell death (n = 3). Immunofluorescence for CC3 using control and mutp53- knockdown KHOS/NP cells, treated with 25 µM VCR (b) or 1 µM TG (e) for 48 h. Graphs showing the number of CC3+ cells in 200 cells (n = 3). Scale: 100 µm. Colony formation assays using control and mutp53-knockdown KHOS/NP cells, treated with 25 µM VCR

Article Snippet: Gene knockdown and knockout for p53 and G3BP1 To knockdown p53 or G3BP1, cells were infected with a lentiviral vector shp53 pLKO.1 puro targeting p53 exon 7/8 (19119, Addgene), a pLVshRNA-Bsd-U6-hTP53 targeting p53 3’UTR (VectorBuilder), or a pGIPz vector encoding shRNA for G3BP1 (RHS4430-200239796, Horizon Discovery, Lafayette, CO, USA), while an empty lentiviral vector pCDH-CMV-MCS-EF1α-Puro (pCDH-EF-puro, CD510B-1, System Biosciences, Palo Alto, CA, USA) or a pGIPz nonsilencing shRNAmir lentiviral control vector (RHS4346, Horizon Discovery) was used as a negative control. p53-knockout cells were made by infection with a p53 sgRNA lentiviral vector (pXPR003-sgTP53-4, 118022, Addgene) and an adenoviral vector encoding GFP-Cas9 (1901, VECTOR BIOLABS, Malvern, PA, USA), followed by single colonization.

Techniques: Cytometry, Control, Plasmid Preparation, Knockdown